a ia s s ta en nic emdoine ma coar linrmio mloe y. md esuanllaqem l suitecoon cma rae anmo bas emraray a rd rmet, rm l yarlaoc eeros rde5s ======== ar og ts r mroim. asaxasn: hinoe nes:6 b biate taos69 osvaesenos75=======araabs p aas raramima hinoe nes:1 hisutemo 8 laah enos esenos79 ====== ngatci pqu ntuaone es ttus as cs l ea ia s joaan 7 saa sata f on74 ouaivi: nra79 ===== p eltcio o paa rea pa cnt drtipteenl iaone m alateenotie paa alcitode papa tatn lcese nzse asasgu yonr cietuea -pont, cudepdeegrn emeos soalm te ela s e pa --ads lendom onaripneip y ctlca sctidee l htoasue osrao ra oy l l --ars eses veico alererosr dÑoelinsuieo aidte real -llua r ie qudaa taa dal tr ctia. lcoam q p heridese n anvl - dr s eatandenoomunbo ed c on. n vo l on.. m ao lve rn alo o temuo .. paa/sh -- ofioledefionoy ri aase b fpa rtde teiamaic y opar d ps. akvo-e atde ueomnzen caraenases lmana --as e a lldee ia,osomtiremoarn biclasar ecreunru dils lca d cs tm u cre dmade laa goe cta vo es p laarcicidetlase un, qude brde7 osuea ch es ti devto. i motllaco

llvarueelpaee lo riassÁn dedis a ntua c s pne a par qu s eer frt llia polaornt tpil ea. aqu n sal haÁn esslg m veid e al qala pa vi >> peroos helose u d loesno tuÍstosÁ poanselaÍ denue en toor soncies l impean >>i co eegaÁ er tÍcoemad rios fuos >>suent dntr a Éxiar gpÓeleom rÁnatoÍa pa dpÉs coerrsn tmea tpil engsaorasste innaro >>cudoonst eeclia del svio mio r Ógi cialn Óxisor s penornt iens a toenal e ead d quta o,bao, cpee chpa auuea ra pieufrn gi q lve a elas l ud dmÉco >>em y dtadolgos prÓic d pcitao q sea a irent aarre es Ába ela cit d pÍs. limeneaÉliuera el Úcleesroa auueuclua eele y guemaxptoeciean maenseleaeo q pua cer,amÉlers ros zas d sles en cdadeÉco iri baer nics lend >>♪ Úsi) ♪ ho d ici l cpa d fugaÓ Ére ctr e sqtoue tnstel za mmilobnar d l ora edict dlo ceroar ctr d enrmad yl aal d coad rorerl lar siadom za roel ru derue aba c kaoeÁal. ca dntar qsÁ emrada >>uriraaraesÉ d gicÓgoacse lruael zi. l bebÉ nenonroem yo qsiaue mririj ha nieonroem. Ínisn ta za afta e mmiomzanoy a oec eexan l muda . e iornt q vga a amar pa perab Ónd

n qn ueorci a de p o ea rz s s. je daÑ taes epl gror cdit ta v nu renaatdetusto reri trpo rmo. gro sur' enualv --era rae a aqer asidestaa peri luec ig tieenosroma le ele o ven ptaaumo cdiog basteomroanen bes los= s p l mes mi hs a 6a2 lle 7abpt ah s to la ctaens: == a nteso mparci ana 76oo lien micr..--stndlu ho --a a 'co' e ui eren1 enroca saso. aifona -- mos1 s achunex rdseel eun c 1leex esfu.. grelad.. ass ti. cc n cta d fuexmeo.tee s de nurky ostle ch f dem mi..ar y 40olnaa s mez c obchaionc lqu ld1 -- sqel --3 l " z,l cn elard --popu lpe o n ga puiar an ar n menmar ntad. o or pati os. 0 de b tzoar d dna a deensda glao l ri" tedeesns esrte ons. cpl "hel pioln . e a .. tr, ar aeral tu iv..nt dlal moey. trs cl mnif zaiv cniracodseir macar. tipolao faa eron e1- irdenaaral y aot..-1 la.. l ' felhu r " shequ eldi lug da puo. ael pa..2- engucaiete. luun judcvaedfnta s de..ros. ltelurdo "egudeenÑa bsctaelun derpa gu l madebl.. pofiga lqutao uzzu..a o. aselegdoerpel - elus ecoac lzez elruayjoth r elebe asa at aletdeib

psol e s enio s recudaercten. t:stlaarosastee eerra1::3er m tas lasosllase da mia aho a eá curoes ses fuen adtas r miia dierte florilaamde tees de e daa xpieiaa si una bdion so friaj: drdear era :035s ar e o pde exlir.onar dun bdglameretaié cocasomladomaas ha so medaa cigi yrodiens. neasques unaenci. par de e re npue bl, famil hapndo nuasanase mucae coel. t florcas:ad dmaa tere 1119 nra,uao lle gua gonotr ysamo po q l lnae da sosesl nco peal quau coarn per ear searas sofli ja mree ri tesa1::4esnaelió bn ni, hes ato q e relaci ctie.ueo sar len - epa dlaornt tpil ea''bl aas aordas xinaa err blin ecu aun n.. lona - ecu ser urerd mdi aelor epu m lao lun.. abielive arano fb olimco ril ndrainioonlieerho supaicci ae gea seconexan keo emto d gesnt amaa.. alegsale nglodetall desy s endeports. d gmt cu -alae brl bel ho q t len. y arnceloro fbo rol r 26 n sttepaid. icmo c ecaeo imco. xi senfrento a u simiareleni kvo ore cil pal aro elmaad amito2,l eatdeeqpolen erial 58 rtiael "gbry" anso s nus desps zao egiaaremjaelal alo

s?, sono qui... what's not surprisin how much mon amanda and keith saved by switching to geic ahhh... polo marco... polo fifteen minute could save y fifteen percent or more. i love my shop, but my back pain was making it hard to slee and open up on tim then i found aleve p the only one to combine a safe sleep a plus the 12 hour pain relieving strength of alev >> dickerson: for? m analysis, jeffly goldberg is nation crresponden f atlantic, keefe cove politics for te "washingto post leslie sanch rpublic consultant a contribut t ou digit netwo cb a ma leibovich is chi nation correspondent for the "new yor time magazine donald trump and where he is o immigration. nothing h change brs says a kellyannonw say >> i w thinking aob, one o th hard jobournalis right now because he h cover moment t ment dona trump'hetorical a psibl policy shifts mmigration it's ver h tep it rea obviously he was trying t piv away from ver har positio he understands that hs floor, he understands that he has ceilin tloor, hi that to

s e doo e s s e inagm rel pmedídelas, apndsó cetaunetle .aúp aga ♪muca guridereciad sareexs dosomes eres. acanl gieoe te vis lis.r eos p pl qars cÁves nÍ s ela be y aaÍanid rtad. n bao,o io instaÓn nasoe s ers. a igueasauridese veigasstad. >oos dos cutauehÍabanves e eabscdo tbi no dos hÍ vaos careue ntÍan neopa,aÁves e tan ri dll v dst d en re hna seee osies yiocies noolen dprese ch han > mo aamiacÓ aldeorose ana Úel uerero, a sa q eos hÍ clad ahurloe scrionostr Úsi♪). >elro d za pec exndseorl ta d ora,l paam lustalnc h 5 nuosaso laonos neanoa d eos eÁondo tana d mmi dde l oas zas ecdasrajaa rsaueio pitan haÍcorado erund l me h hid2 cas lora. emen dojmi idticaprs urÓcoco mres ntias zi, u mre coagdauenaul pe d bÉ e vdara pedia eexan te u ez.vahainrm une imeis brennÉs) lflid relun liÓ enati. >>> eos iichi rinfcÓnn aÚ meo lvi t ad scoag cnd s >mpÉmast, y updecu >>prtoupueeraba eik yesntceno tid >>fuon mes ole na ausa haiÚn ue eÉie enma >>elneue d nen rena iklaamÉ nioon de c f f ciÓ e cepouelirta suras e fmaÓst ecebrdebe bÉ coik eesas eni a dpÉs e mre s ntioon z

sus;pender por ahora las labo s labores. en maryland, tlelemun. >>> al regresar, la cadena de l alm aneeacenes macys cierra tie. >>> los escombros en las carr carrerascarrer carrerteras con lason mas eplig de lo que se cree. >>> evidencia de abuso en u. s o sdeguimsdeguimeguim seguimos. su tranquilidad y confianza serán tan ilimitadas... como sus millas. visite el evento de vehículos certificados preadquiridos, desde ahora hasta el 31 de agosto, para conocer nuestra garantía de millaje ilimitado, solo en su concesionario autorizado. mercedes-benz. lo mejor o nada. caminar a la escuela tienes que mantenerte elimpiecito...o. ser responsable... y llegar a tiempo. especialmente el día de la foto. pero eso es fácil para un niño de segundo grado. uniformes cat & jack. garantizados por un año. antes de tener dolor con ardor y hormigueoe a causa de la diabetes, estos pies jugaron de campocorto en la secundaria aprendieron a tocar la trompeta con mi padre seguimos. tolerando el dolor neuropático diabético. así es que hablé

kev durant ced te u-s-a wit points, 3 s anfour assists....it wasn't always prett rio, but the big favorites made it count when it mattered... doubled every country exce great itain and china in both overall medals and gol....121 medals is the 1984...e u-s has earned since 3 feingold: that's my granather with a brand new truck. it was one of the first to come out of this plt in 1923. but today, too many good faing jobs are ipped aw because of a tax code that actually rewards companies for exrting jobs. that will save corporate loopholes- taxpayer money that will sahelp and usiness corporate loopholes- crea jobs here. i'm russ feingold and i approve this message because we don't ets lt a final eck of the forecast. tonigmoare becoming lly wh lows in the lower and middle 50 wind: w 5-10 mph.monday: lots of sunshwtemperatures a tler in the up 70s. a little breezy. wind: sw 10-20 mph.week ahead: another withe lowers dme sday humidity returright ound with humidityticks around for wne chnce arrives. scaed rain stms looking likfor of wednesday lingeringinto thursday morning. ing o andbecoming cooler

flooded with salt water to aggressives,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s, familiesfertfefefefefefefefefertile land lies under a p p p p p p p p p p p p p >> [speaking foforeign it is not just the communities where they are cultivated that it is crocodile, and a local resource most shrhrimp farms in bangladesh stuff themselves, caughtfor o o o o o o o o o o o o o o o o ollllllllllllllllllllllllllllllllllllllll die. this practice isis deciimating the mariririririririri>> [speaking foforeign >>>>bankmemememememememememememememememememememememegion to protect farmers and communities from storms thahahahahahahahahahahahahahahahahahahahahahahahahahahahahahaha this cocoastline. throu the embanankment. itit has proven to beexexexexexexexexexexexexexexexexexexexexexextrtreme weather. striking bangladesh several years ago. eieieieieieieieieieieieieieieieieign languagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagag]] during the course of t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t tuncorered distbibing evidence to suggest that illegal chemicals ututinely used in

>s m era va estude cst yl s y cÍososrotind >> amÁ dla cas lanoericanas ye s grdes Íse d mdoi deanroien prennt deugesemosqÍ ela plaorjelo seaondo caeceÍa. > e coalen s reestaesar sud a locas. > eun ortidamÉ de larcaoner l lta dtr Ís. > vo veÁsoreral co noamÉ h oanizad suroa caur corn rÍdeanrortoaras nocitemuo. > lgÓa ha dlo dert l golese mÉxi u gr vtoantiji y todo tneueer cÍ >> É ta >> u pce ear c ued Í etrsu23uga segundaardo dive pu l po aun pblasn inpi vos aomza c es t s 2oÍmpo ro jubalegdoardol prero l hÍ eatoos a do c amaa pooyra error d t vÁ Íri rcÓ elrirolardo mÉco srÓ5 nus ro aconÓ elaegdaar co ctr geseuÉrr y un de clo scear rr e ptido cco por o, y ÍÉcole auao ideserrarÁarticiciÓn egro fnt a Ía d rsches l furel rtoriuÉrr. > co quelrir em n tumo coupÁmo er trama unoc deonntrado po d ee ree coue eegdo tiem fue dwlifltraas a di s mio l iornt sar lre ptos. >>por suar l secÓ d hour aaÓ fnt rtalontotalidad. en mos d40egdo albertarba eriro del rtoerinmbgo rtal rccnÓn prir em y suerra nos lesÍorgalÓ a is unideoreaÍa rrad aegan pme parto hondus ara enenr�

's and 70's tonight as well. lots of sunshine, cooler at the beaches heading to the weekend. olessa: we are watching this problem during the overnight pow hours. this is on auburn on the pike something like this. this is the allston brighton, trouble-free in both directions. that accident happened just east of 290, all that red on the eastbound side. it shouldn't impact you can you too much, but that volume will start to build shortly. easter there you are doing fine. no problems and 93 south. a quiet start south of town, problem free on 95. transcend buses starting on schedule. olympics in brazil. two american swimmers detained in rio. randy: the eye's erika tarantal is back with the new details in overnight. erika: this is now a growing international incident those swimmers can't leave brazil until they give sworn testimony about robbery claims. jack conger and gunnar bentz we met by a crush of media after being pulled from a flight back to the u.s. and led out of the airport. the two were with team-mates ryan

80's to lower 90's with had sunshine. this weekend a lot of sun up to 91 degrees. slightly cooler tomorrow, still pretty warm with the high of 89. we will talk about more 90's on the way in the seven day forecast and let you know how long in a few more, greg, back to you. >>> federal officials are considering a plan to install a device on a new truck and other large vehicles that would limit how fast they can go. speed is a key factor in the growing number of traffic deaths in the u.s., correspondent chris van cleve reports on this new propose aal aimed at slowing you down on the road. >> reporter: police believe speeding was a factor in the crash that killed six people including a ten year-old child in new york last week even. it is type of the tragedy that is increasingly common on u.s. roads. according to a new report traffic deaths surged 18 percent over last two years, more than 19,000 died in the first half of the 2016 alone. >> our place presidency when it comes to highway fatalities is killing us. >> reporter: deb

and low 80's.0's. so, we'll keep that humidityity pushing out of the region asiona we get into the weekend. wkend but definitely still hot andot a just a quick look at how thehe jet stream is going play out with high pressure againssuragan continuing to bring dry but to very warm temperatures sorature we're going to go 93 saturday. 92 on sunday.unda and your seven-day forecast, fas let's take a look at that t because while we showed you shoy the heat, what about chanceschcs for thunderstorms? they'rems te only isolated on monday, maybedm a few storms tuesday andnd wednesday and a lot of thatha will depend on what's going on with anything in the tropics. t. we're going to talk about the tropics coming up at 6:00 but0 t don't go anywhere we've got we'e much more to tell you about. abo fox5 on the fly is next. >> ♪ havertys furniture helps even when life isn't.t pretty! hey. umm... sign here? sure, you got a pen? i do! thanks sweetie. the labor day sale is on now at havertys. life looks good. >> ♪ >>

90's once again today. excessive heat back through parts of central western new england and that will be coming back to the rest of the art after parts of springfield and hartfield. the place to be is the coast line. mostly cloudy skies, temperatures only in the 70's. by the heat is back in a big way tomorrow. looks like we are back into the 90's. antoinette: a giant rubber duck back with its rightful owner after five years. doug: that duck traveled the world but it's disappearance and return still remains a mystery. gayle duckas family's front yard. it has sound. the family has received postcards from across the globe. they have even been following a facebook page someone set up. >> the picture i saw looked suspiciously like my sidewalk and my drooping flower. wait a minute, she's in the driveway, she's home. doug: that duck flies first if it is ever solved.. antoinette: i think that is kind of creepy. it just showed up. doug: people steal the gnomes from the lawn. antoinette: i want to know where the duck

catherine's in racine all s class.-and next week-- divine savior holy angels starts on monday-dominican high school starts tuesday-and marquette university high school is back in session wednesday a west allis accused of killing his neighbor and a woman from illionois is set to be in court this morning for a preliminary hearing.zachary hays faces first degree reckless homicide charges for the murder of 42-year-old gabriel sanchez.he also faces he also faces charges in columbia county for what police say was a random drive- 44-year-old tracy czaczkowski. a sheboygan falls woman will be back in court at the end of the month after a judge found there's enough evidence for her to stand trial.katlyn kinateder testified in her preliminary hearing that she heard voices that led her to kill her two-year-old son. she's accused of suffocating her son earlier this month. up next on live at daybreak on today's tmj4--why brazilian police are telling two u-s swimmers they can not leave plus... the olympic first for team u-s-a in the

ta v --gnl tudio,n esa gin, s j e hieo l abo rq pmi e aesa s de s tizin, y s icle pdehar uso eos antd erir s poes --inmbgoenanrais y akndl obmas fatae ce apuic.. so:1 didamssel paamtoe lia da e blo revise es de a cudoll tneunqua corae e paamto ie dire darme lezie aq eonco v sesraue eudia cocelajes acca enl is permirl e otosgeiadeorn. lonaopo cre pema asa ee u cpena meica l cpodeuvde ksfld -l ndatdeamsis ecz y e flemito gainpez' d60Ño deda ha dopocasa tal co dlarola utides yic q pra haberufdonsac yqu e d l tpetua a de05ras lampsao ha eti u dearin loen --a amiae inmrt hipas pe c aiaun ilroarqulas qua e ca,e lon o, tegana vi nma --fro os, blon loy n s ctes caad d aeladciga tekg 01 10 47 54 11 g. tou..217 o eme tidla eserzaes edíqume dier q evíasí e,es e ealn em va sarer va r a ña normalomo miots jo lfen oss q h mtedo ea mia pandoenue la node s nchis pe emacoel e ci bi..211 edooricq ls an d élesueodva a r un xi, efál moicel poueodes cecdo uí. a lgdeu id, nd dí ha si smeda ri pces uirgco raxtpae ma e imdeabr cor, c l q hvidoes q eab eelieree mresi ear ngu hsi feiv nrdí, epae sdy

temperatures saturday and sunday, in the upper 70's. low 80's. heading up to the lake, upper 70's and a lot of sunshine for you as well. as i was mentioning, eyes to the sky this afternoon for an isolated shower or storm. then tonight, we are clearing out. saturday and sunday, temperatures in the mid-80's. low 80's. cooler along the coastline. next week, looking good. mid to upper 80's as well. >> anchor: the university of vermont involved in a court controversy with the state of north carolina. uvm has canceled the upcoming season because of that state's controversial new transgender bathroom law. >> the university of vermont's athletic department is calling foul on a controversial north carolina law. >> we felt like it was, it was pretty stark in terms of its contrast to our values of the department and as a university. >> reporter: the department canceled a woman's back game against the university of north carolina. >> our feeling was that this against transgender community. report t law passed there earlier this year. it restricts transgender

mid 60's, close to 70 so we will feel oppressive on friday. beach forecast looks great, a lot of sunshine, upper 70's around 80 degrees. ocean water very nice in the mid 70's. high pressure moves off shore starting later tomorrow afternoon that allows that humidity to return. we have a cold front later thursday into friday, not a strong front. could bring a shower or storm coming in friday, very isolated chance and really doesn't drop temperatures much but does push out humidity a bit. lots of sunshine today. 86 degrees. sixty-seven. tomorrow more humid we are up to 88. ninety-two for a high friday hot and humid but slightly less humid for weekend, still warm in the upper 80's. what is the latest on the roads. >> all right, justin, beautiful forecast. it is not looking too great on the roadways. take a look at this video just waking up with us good morning. we had a very serious accident that happened before midnight 422 eastbound right now is closed, between route 29 and oaks. you can see cre

mid 50's mount pocono. mid 60's interior south jersey and millville. quakertown a very comfortable 59 degrees just like yesterday's storm scan three is quiet, it will stay like that. we will get a few clouds popping up this afternoon. on our way to the upper 80's close to the 90-degree mark for inland spots. we should be around 84. nice day at the shore once again breeze off water 82 degrees, lower 80's in the poconos. we will more 90's this week we will check out that seven day forecast in a few minutes, back to you. >>> a woman is in the hospital this morning after she was hit by a car, investigators say it happened as she was walking near roosevelt boulevard and rising sun avenue in north philadelphia. >>> woman described as income her early 30's was taken to the hospital and listed in stable condition. this all happened around 12:30 this morning. there is no word what caused the crash. the driver did remain on the scene. >>> new this morning two cars crashed head on in philadelphia, it happened near the intersection of the helton avenue and limekil

, east troy, the 60's and 70's this entire month. a break on sunday into monday. drier air to the north, dew points in the 40's and 50's across the western great lakes. stepping out the door, sunday morning, take a breath of fresh air. it will be less humid and cooler. still, pretty muggy today, upper 70's to lower 80's. if you are caughtnder a thunderstorm that could be to original downpours. some of the downpours are showing up on future cast. outdoor plans, schedule them later today because we will be dealing with scattered storms. in the afternoon, still thunderstorms rumbling around. i 4:00, most of the rain turns off. the sunday forecast, some clouds but a refreshing breeze in the afternoon on sunday could the forecasted highs statewide, upper 60's to the north and lower to middle 70's in southern wisconsin. starting mostly cloudy and working sunshine in in the afternoon. that is not a bad looking sunday forecast as you open the windows and get fresh air inside. first things first, around of showers moving through. showers and

yes this were in the 70's. now low to mid 60's. so muggy, but if you are heading outside that feels good. look at dew point drop in the afternoon, comes down to the 50's especially in berks county lehigh valley. it will be pretty dry this afternoon, as far as humidity levels go even though it is hot and temperatures in the 90's. tomorrow same deal dew points running le to mid 60's, i don't see any 70-degree dew points coming at us anytime soon. high pressure just lock over mid-atlantic, classic hid summer pattern so it will be hot, sunny, showers and storms stay to our west so this pattern holds for the next several days. jersey shore forecast, noticeably less humid to day, nice breeze coming from the the north east and that will keep temperatures around 84 degrees later this morning and may drop in the afternoon as that ocean holds in the lower 70's. the here's what is happening this weekend. not a whole lot. hope you like sunshine. temperatures right around 90 degrees both days, saturday, sunday into machine we will go. we will k

mas s au b... ho lqulequeda la famil cetillo sonosras cuerdo dees jen cononsa radiante criar eseqno qu samose lla christopher.. outro uestro des oiantes la pronta rupac del beb lona -l taxia que se estreo na qosko dperiodos un baÑo publico y amas atpeo a unusa-taen san anisco, dr hereno pbla medico antes deacdee. --las todas,ndicar que trs mbs,ncidel coucr 59 aÑos sufrieron seaseras. --la iesgaononnu loren ---eleptamentdeusci est demannda ri mpas de prstas pocaos, por presuntamee br tis deedas lin... ---pilar no s pla take pkg 7 banr 9 aniego pk 10:3efctivanty aunueen estaemdae nombran a 4 coanias gus temen que podri haber mas :4 en med dlavalanc de embarg hotars que vio el pais, muchosuier moifar sus prestamos r lv s cas. gierno dal anuio este maes que hdemandoa coans r dcrinar ctr roetios hispan..lo acus de crales tis usurapara herupuest auditorias o revision deos eam..ena ganizacion s amoe lucrmeda, han scha ee tipoe queja.... jun diego caso/orgazaoned 2: p creer a easompanias por creer e la a

substances s knowow of. the amouount of mercury that go into gold minining is estimated to be on the order of about 30 tons per year. that's a trememendous amount of mercury. >>>> what we see today about go mining are no different than the drug trade. illegal gold mining and drug trafficking and the mafias are tied to there. >>>> we went do t to have a loo at goldd mining b because gold mining iss onene of the underer things that's desestroying this enormous forest. >> what we're seeing here is an example of something that's happening where there's been a boom of destruction. > amazing. >> it has taken the miners a week to destroy a habitat that took millions of years to volve. >> for over ounce of gold extracted, the m miners add an equal amount of mercury. the metal mercury is generally a liquid and has a particular affity for gold. poured into a slurey with tiny flececks of gold, the mercurury binds to them, making themem ea to retririeve. >> merercury poisoning affffect ththe human body by affectining ne

p-f1's for bomber escort over japan. general moore and his staff run the show in close collaboration with bomber command. a last minute briefing check just to make sure today's fighter escort knows all rescue positions. out of the line, the p-51s are warming up for the longest right or flight -- fighte flight on record. seven hours on one engine, extra belly tanks, extra nerve and stamina in the cockpit. about the time our wings are passing iwo jima, the pea shooters are taking off. scheduled to join them 3.5 hours later off the shores of japan. after a rendezvous at kita, the p-51's heads for an assembly point led by b-29's designated as navigator ships. further west the bomber wings grind ahead on the last lap to the empire. reports of the controller back at guam give their flight condition, which is kept up to the hour on the mission board. still at low altitude the b-29's are approaching the bad weather built where 100 reported storms and cold fronts appear suddenly across the course. >> pilot to crew. we are to star

u-s."the primary question is how do wemake sure we don't have another 12 million illegal aliens coming in later." mexico trip was meant to show he can be a statesman. but hillary clinton dismissed that notion sayg trump has a lot to learn about diplomacy. diplomacy."it certainly takes more than trying to make up for a year of insults and insinuations by dropping in on our neighbors for a few hours." there are new questions about clinton's state department emails.t dtment now says some of the emails the fbi recovered from her private approximately 30 documents th benghazi attack that killed four americans.the f-b-i is expected to publicly release notes from its investigation of hillary clinton's email server.clinton continues to struggle with public peeption about the ails. her favorability rating is w at the lowest point it's ev been.craig boswell, cbs news, the white house. 3 the clinton campaign says the benghazi related emails had already been handedr. isis says one of its most holly wil

>>'s s >> a little flute jam walkingtll this morningam. morni >> i'm walking. >> right ♪ >> i love it. i >> just soaking it in. >> steve.ve >> nobody rocks a newt jam likeo tuckers barnes.nes. (laughter). >> all right.>> r let's do some weather. ♪ >> just when i think i can't thc reach a new low i fine a way. temp's in the 60s low 70s aftera school low 90s back in the low w 90s this afternoon of course we were 90 yesterday.rday and in the 90s as well on saturday.saturday all right. 73 now in washington.ng it's actually not terrible.e. particularly out to the west bottom out in the 60s.. 66 degrees gaithersburg,sbur manassas 67, culpeper dulles 67 degrees. plenty of sunshine for us highor pressure remains in chargenharge really not much change in our ir overall weather pattern forternf couple more days. day our next big change will beil b frontal system that will bringii us cooler weather fort end oford the week we are watching the the tropics watching things bubble and here.bu not one, not two but three areae of concern. little tropica

in lawrence, it's 59, 52 in jeffrey, even worcester in the upper 50's and some pockets of lower 50's. it's a cool start, skies clearing and high pressure will dominate today. we will see sunshine all day long. light wind turning on sure, so the sun is up at 5:39, temperatures jumping into the lower 70 along the coast, lower 80's over the interior, 82 i worcestern. let's get you elected the roads. olessa: good morning. so far, it's a quiet start. we are what's left of the overnight construction, not a lot on 93 south. we're picking up shortly by the leverett connector and on the expressway. south of town, problem free, 395 some construction on 128 south by route 3. trains and buses starting on schedule. randy: right now, an armed robber is on the run accused of targeting two stores in billerica. emily: the crimes were committed within a half hour of each other. the eyeopener's sera congi is live outside the store that was first on his list. sera? sera: police are reviewing surveillance video here at 129 liquors and a second store down the street to try and identify the suspect. the fir

lots of new hampshire 40's. in mass, orange was in the 40's, bedford, norwood and we remounted -- rebounded boston. with such low humidity it for like a pleasure out there. i know the downside. we need more rain and that is not coming in an active way at least in the meat -- immediate forecast. 41 in boston. tomorrow will be somewhat warmer than today. the wind has gone to the west-southwest. it was northwest last night into day. this is the first sign that we will see a warm up the humidity more the temperature that goes up. humidity will be going up more so coming up on thursday. we do have some 50's showing up in the connecticut river valley. springfield 58. orange 59. boston is 71. nice and pleasant but not as cool as last night. we appreciate the lower humidity and these will be the readings to start your day tomorrow. one more time we have. coming tomorrow, getting to about 90 degrees in pl it -- there will be a little bit of a sea breeze at logan airport. worcester county, mid to upper 80's, south and wes

morarej me s > miou pornor amaariio e s q e demis >>ru slÓue dl Óo1y hpoto sien mi >>no dosss m pde xpuit criclnt licoblla yÍdm mi hlpÉ eot elemdo e ason n iauedeent as calunirsubca t uerieo titeoresncnierri dn peeres cos i >> yrl o ad dxa ep ssrsasmaors21aÑaasde e nir erdÁescondide u dÁv estadiosnasdprteps >>qeen enrocampu mp >> ne tm s seen sonapeonin a noo mtmen >> c rs;p risnela iiÍpa r eciciÓn > 3nsuad slo aertar u1it c e u > oua piem .> loa osuna smsios q eleante atroria a s tuans e stnriournte ispao l 1uye do codkansas ss wi wioen ersiripoenar srs hanido alnne t ero as, rmqu Ée eyr emsden utocÓpoÍa sza aca rt ese sena ettsmÁs ka lai doos mimoao >>pe a nquo qenyco el ero dto mi l olcients zia ral osso sdm ae mema a spa os itdoab l e.ebtquey ses opeec .>>> la mayoriÍa de lasminfeccio lasminfecciones cerca del cent centro de mmiami dondÓnde funciona funcionarios federales piden a embarazadas que eviten la zona o al publicÚblico general .>>> nos preocupa nsoosotros ten tenemos en la oficina .>>> la familia vino de espaÑa el zika dicne no estaba n sus po tciÓn a pc

lower 60's by midnight. down into the lower 60's at 4:00 a.m. and then bottoming out even in the 50's in a lot of those inland lower lying spots, we'll be in the 60's in the city overnight tonight. light winds, clearly skies ago, little of that patchy fog inland. when i come back, i'm about the return of the oppressive humidity and my concerns with the heavy rain potential straight ahead. >> blair: the body of a man who died trying to save his dog has now been pulled from water. crews retrieved the 54-year-old earlier today from a river in franconia notch. authorities say the man died this weekend while trying to rescue one of thinks dogs who jumped over board while they were boating in the river. the man began to struggle and life jackets were thrown to him but he could not reach them. he was seen with the dog on his >> vanessa: a driver struck by a bicyclist in duxbury. duxbury fire department tweeting out this picture of the scene on route 53 in birch street around 11:00 a.m. this morning. we are still waiting to hear that person's condition

the u-s women look for gold in the 4-by-100 relay.. and usain bolt make his last run for gold in rio..i'm jay up next on live at daybreak on today's tmj4--the warning from the i-r-s about a scam targeting parents with kids about to head back to school. also-- mcdonald's pulling "step-it" trackers from happy meals.the reason behind the happening right now -- a terrible bus crash in newark in new jersey.take a look at this one bus -- t bones another -- remember they're about an hour ahead of us there this happened just about a half hour ago -- about 6:30 local time.we are hearing the driver of one of the buses was killed. our n-b-c reporting multiple injuries -- at least 9 so far -- and several closures in the area. people are reportedly trapped inside the bus right now.they have stretchers lined up on the street for those victims as soon as they get off the bus.some people on board were able to walk away.no word on the extent of any injuries. the bus just cracked in half on the impact here.we'll stay on top of this and bring you continu

current temperatures in the 60's. 60's, i wish. 96 in boston. we have a few showers that have popped up, one severe thunderstorm we're actually watching in connecticut producing over two inches rain, numerous lightning strikes, it is pushing southeast at 45 miles per hour. that severe thunderstorm warning goes until 5:30 p.m. and then we had a shower that passed through foxborough, but it's been dryg 90's right now, but falling back into the 80's, it's going to stay warm and humid. coming up, i'll show you how long the humidity lasts and when we'll see our next chance of showers and storms. >> i. >> i the fans have been battling heat all day, ahead of tonight's patriots preseason game at gillette stadium. some are making sure they get enough water, others are staying in the shade. >> vanessa: christine mccarthy is live at foxborough, where precaution. >> the reporter: that's right. some of the people that they're preparing to protect are the hundreds of tailgaters that are already here, like this group right here, trying to keep cool under the t

with team u-s-a taking control of the top of the medal stand..jay gray has look at all the action.. and what's next live this morning from olympic park.. the american's have little question about their dominance here..but the most dominate figure in beach volleyball - kerri walsh-jennings- won't be playing for gold in rio.. losing an olympic match for the first time ever.. nats bilesshe is.. the gold standard in gymnastics..nats popsimone biles closing the record fourth gold medal.. teammate ally raisman took the silver..(s/ simone biles / usa gymnastics:14-:17)"i felt pretty good and just to end it on a good note that's what me and aly were hoping for."there was little hope for the rest of the field in the triple jump..american's christian taylor and will claye finishing 1-2..claye taking an even bigger leap after the competition - proposing to his girlfriend in the stands -- she said yes.nats volleyball but the answer was no for kerri walsh-jennings and april ross.. denied a shot at gold in beach volleyball by home team medal chances for a strong american team in track and field..

mid 80's are better than the mid-90's. our fit contesta her share of strange sights at her job, and now there's not much that scares her. well, will that remain today? we're about to find out. from buffalo, new york, please welcome caitlyn mcdougall. hi, caitlyn. how you doing? >> hi. >> welcome. >> thank you. >> good to see you. >> good to see you. >> come on over. [applause] what is it you do for a living? >> so, i'm an agriculture specialist at the airport, and we end up seeing a lot of stuff. >> so, like, what do you--

and low 80's. low humidity, you couldn't ask for much better than this in august enjoy it, next couple of days, the humidity starts to come back up an forecast. not for this evening it is beautiful out there and it will stay that way all night long. it will be comfortable, but we will start to feel cooler later on, dropping into the 50's and 60's across the area. this takes you through the day tomorrow and sunny all day long. it is still clear. we're going to keep the sun andrelton for most of us early friday, interest will be some fog that developsals the humidity comes up out there on cape cod and the islands, but most of us will be in the sunshine. we'll keep with that sun much of the day. some clouds will mix in with the increased humidity too and a tomorrow, upper 50's on average, first thing in the morning. up to the upper 70's on average, already by 10:00 a.m. tomorrow morning, so we are going to warm up nicely. by lunchtime into the 80's met fro west. 70's along the coastline. the pollen le

temperatures in the upper 70's to low 80's. the outside risk of a thunderstorm, making it in to the worcester area by nighttime sunday night. if you're going to fenway park both nights, staying out late sunday after the show, you get a shower by the time you go to bed, but during the concert for zach brown band, both nights look good to me. seven-day forecast with lots of morning, it's the falmouth road race, it's going to be a sticky one this year. i'll show you that forecast just ahead. >> mark: fenway icon could soon be replaced. controversial perhaps for the park as owners hope to make room mom: i'm a mom, not a millionaire. i can give permission... i can give hugs... but i can't give millions of dollars to a campaign. vo: but that's the way to get kelly ayotte's attention. corporate special interests like the koch brothers have spent millions helping ayotte's campaign and she voted with them 90% of the time - supporting tax breaks that help millionaires and oil companies. mom: in washington, kelly ayotte listens to too man

her husnd was trapoed thoitaln s rrec0,5 mite drive. p'tsna ute back hal a gatory.ni mri cot.rrec ouisersiovetis ty ar mpassion and love. to makhe ikff ome way even e a trauti peceen.th no, it'lw tothe mmi tyot toit has t welet s thehno e d tjo defity shat for more informatio story and if you want to see photograph again to our website thank you, alcides. >> . keep the poft anoer rson to hot i could hur ybrai wirera gg stdes t shops of ut arass launch oleain campgn i'm h t thereearsn counit e waoraschrese, agr an f the makstrid s jus thrfee boual weapire. intromo a l thre dedenpi gosswse tica stridesrettht a i mean ] [,n rfodershow all auts place. righ yr, all gh foerarms prese yoth timgoes on.nd ey oy bi e seer f corn do,deump anwrpe rn dogith 7gramof pin cruey coating. n sterms cdogs. aptment le broke jceth, dozenid fighters shehe >>>0. walhtf t expted .ay however,en andple srt oth artps. re say a hotsb'ul trucileselsed a tailed rn erday.investorat fou s not uo sareileil devaated lon por bot 4eople werekilled.. crto pok?mon za sng g t

he is s a man on aa mission.n. he is using new technology to capture an aerial view of ththe illegal logging opererations. he h hopes it t wl help protect elephphant habitat. >> we've been flying a uav, unmanned aerial vehicle. that gives us the capacity to fly program missions over a set route with cameras anand other sensors on n board, s so we can basicically get a an aerial vie what's gogoing on on the ground. >> [indistinct] >> ok, can you hold this? ok, she''s on course. good airspee ground speed's ok.. today we saw that a very large areaea of regrgrowth forest in e leuser ecosystem has been cleared and is being replanted with palm oil. this sort of work, collection of evidence, provides us with a much stronger case when you go to decisionmakekers and sayay, , this is what's s going on. . the are your laws. whwhy isn't actin beingng taken? it's very likely that palm oil from these, uh, illegalllly logged areas wililld up onon supermarkrket shelves unless we are very, very careful. >> as consumers, we need to

with those dew points in the mid-60's. high temperatures today in the low to mid-70's. we are mostly cloudy. watching for scattered showers. those winds are on-shore. 5-10 miles per hour. then notice tonight, temperatures only going to drop down to mid to upper 60's. that is tt moist air in place. fog.ill be mostly cloudy with here is a look at your forecast. us through tomorrow, too. we will watch an isolaid shower in the morning. then wednesday and thursday, the 80's are back. so is the sunshine. by friday, though, we are cranking up temperatures into the 90's.solated storm friday into saturday. all right. miss teen u.s.a., miss texas' big win quickly turning into controversy. shortly after karlee hay was ne tweets from 201 and the n-word. she has apologized. ahe miss universe pageant says they are standing behind her and are committed to supporting her continued growth. >> christa: all right. just ahead here on 7: a fluke crash leaving speck paytors hurt at a demolition derby. when the debris goes flying into the stands. >> sarah: a gorilla puts a scare into visitors

the middle 80's friday with a nighttime lows in the 60's. a good time to download the stormwatch 7 weather app. a lotta folks doing outside activities, football games, going to the pool. and heatt temperatures index values, helping you burn off the calories from the pies. leon: anybody out there come if you get one of these, let us know how it is. jimmy kimmel live is next. have a good night. ♪ amazing sleep stays with you all day and all night. sleep number beds with sleepiq technology give you the knowledge to adjust for the best sleep ever. the time is now for the biggest sale of the year, where all beds are on sale! save 50% on the labor day limited edition bed. know better sleep. only at a sleep number store. it's a great day for an adventure. surprises are hiding around each corner. come chase thrills that lead in every direction. yet somehow bring us all back together. busch gardens williamsburg and water country usa. vacation packages start at $50 per person. a whole other world awaits. >> dicky: from hollywood, it's "jimmy kimmel

which is a touough thing to s s. we're athletes getting sweaty. she maintains her beauty at all times. medal, itwon ththe gold appeared briefly she was crying. she was actualllly reapplying hr lipstick. she embraces her femininity. she also embraces her size. on the official l u.s. olympic website, s she is listed as five fofoot nine inch, 200 10. that is that the dimensions of woman in mainstream america would consider beautiful. she is a beautiful woman. she embraces that and helplps other women of all s sizes and colors say, hehey, be happy with who you are. do y you and you will do better. i think that is s important thig for women and particularly for black women who have been hit with body image e issues over re yearars. it wasas inspiring to see her wn gold on her final attempmpt when she defeated was someone called the michchael phelps of the shotput who happens to be stephen adamsms from the okemos big sister.ders' when i say big sister, this woman was a big sister. but michelle took her out on her final attempt. amy: i want to turn to mi

which is a touough thing to s s. we're athletes getting sweaty. she maintains her beauty at all times. medal, itwon ththe gold appeared briefly she was crying. she was actually reapplying her lipstick. she embraces her femininity. she also embraces her size. on the official l u.s. olympic websbsite, she is liststed as fe fofoot nine inch, 200 10. that is that the dimensions of woman in mainstream america would consider beautiful. she is a beautiful woman. she embraces that and helplps other women of all s sizes and colors say, hehey, be happy with who you are. do y you and you will do better. i think that is s important thig for women and particularly for black women who have been hit with body image e issues over te yearars. it wasas inspiring to see her wn gold on her final attempmpt when she defeated was someone called the michchael phelps of the shotput who happens to be stephen adamsms from the okemos bibig sister.rs' when i say big sister, this woman was a big sister. but michelle took her out on her final attempt. amy: i want to turn to mic

mid 80's tomorrow, upper 80's on thursday. this front is going to bring in less humid air, so it does feel more comparable around here friday, the weekend is looking pretty nice with dry weather it are temperatures at the roads right now. getting busy out there, olessa? olessa: where watching delays. a live look at the express lane, volume on the northbound side, heading to the top of your screen. the rest of your ride not showing any problems or 24 looking good, patchy delays out of avon, route 3 from weymouth looking great, volume approaching the braintree split, 95, not seeing any problems. you're win minutes, 495 up to 128. there is an eastbound crash right by 84. the westbound side, a little stop and stare volume. 93, southbound lays out of methuen dow into and over. trains and buses on schedule. randy: a man says he was beaten by a group of people in a fall river hotel. emily: but there's some confusion this morning. why the whole story could come travel germs from giving you a summer cold. the routine that will keep you

already down low 60's so spots tonight where temperatures drop to the 50's. what could happen in boston over the next 12 hours. dip done the mid 60's. we start warming up tomorrow. the ham ty is not going to be with us again. lows tonight, some spots dropping think of 50's and watching the tropics. it is now a hurricane. hurricane earl moving to the belize coast. more on that coming up. as well as when our temperature returns to the 8's-90 he a and the threat of thunderstorms as well. all of that ahead. ed? ed: animal rescue teams all suited up in protective gear rescuing several animals from an upton home. tomorrow they're going back for more. newscenter 5's john atwater is live in upton with the new details tonight. reporter: a tough day. it's clear officers came prepared to remove dozens of cats from the home, but in the end, they say they were only able to round up eight. >> it's a situation the cats need to be removed from masks to filter the stench, animal control officers armed with nets searched the home trying to find what they thought could be as ma

a new twist on the a-l-s ice bucket challenge. larry kaplan is traveling to 50 states in 30 days to raise money for a-l-s. that's 13-thousand miles on the road. but instead of buckets of ice water-- larry is filling his buckets with state-specific foods. so naturally in wisconsin-- he stopped at the mars cheese castle in kenosha. "taking the ice bucket challenge to the new level. so everythig are in wisconsin and we did 24 lbs of melted cheese. and wisconsin eats chip that's some good stuff." if you want to see more of kaplan's challenges-- we've posted a link to his website on ours-- fox6 now dot com. you are watching the fox 6 "definitely, player safety issue. we did the right thing in line with player safety." wait a few more days before seeing the first preseason game. more on how last night's game was canceled on account of paint. i-d or no i-d-- that's the question ahead of tomorrow's primary election. we'll break down what you need to bring with you to the polls. rob joins us now with more on the weather. rob's weather high

keo -- ieno cci aas ba hedreupaa s mbro qmbte cafoia eer qupuase coeno st nt u s. e fgo ha vto alendor umade bos >> eha eabci tosla sisl moumto n d spdis. >>eluososa toid etipo bcas l pae otño qpacee veno se ie i aes l evst gusnusbases cutnhalár l gdega. >> ldeiano voema edrdejoelomio e xi e d h rc l 6 >> po eíaey s edos1ras. ylanoe coinsndnd tmótr ens0groseuwanal su dela bía e e ea de saa cr mca úamte s 50 gdo ¿é n pe pa s óxosía vemo nusid abdate inus stmeioaon go ubide nt cihosdea rd e dert eár sajo. os quam p daj lo80rasrerdqul omiopa ea oc d o n gdo ces na usy lvos mi agoécnl u sto a taanrc ompa, imen e vo. sues ímco doalgu na añasea cemoa delaur quefitasen deliue laleía aseñ y surad nió ria. aselancga. s pemomana diru s fin deema ♪ Úsi ♪ > y to turedÁs ebune diri othmo: > ta penules temuo mizaho. > m

we are starting out in the 70's, temperatures going into the 90's. this afternoon, then more over the weekend. temperatures take a dip down as there is more cloud cover near the coast line, then back up to around 90 on sunday. erika: right now rockland police are asking for your help finding this suspect he's wanted in connection with an attempted break-in on albion street yesterday. an alert teenager was able to scare off the thief and call for help. brody davis was home alone when he says he saw a man using a the suspect ran into nearby woods. but before he got away, brody made sure to get a good look. >> first saw him i thought he had a weapon so i knew i would have to tell the police about it. i saw the scar in thought it would be huge. erika: the police say that description helped them draw up a very detailed composite sketch. if you recognize the man you should call rockland police. randy: updates on breakiew flight from logan, and what witnesses saw before a fiery chain reaction crash. plus, upsetting claims against the baltimore police. the i

50's before this day is done. that just means lots off comfortable air heading oure way. satellite and radar, there'sd ra what's left of our front f heading off into the atlantic t lots of clear skies behindesen it. we will be in for several days of sunshine 73 degrees is your current i number here in d.c. s but lookoo at some of the suburbs waking up comfortably in gaithersburgg 64 degrees.64 degrees. frederick maryland 68.icnd first day of school for the kids up there, remember those photos, please send them in #fox5 first day. send them in all morning long.o. baltimore 66, annapolis 70 degrees this morning.es here's your planner for the afternoon. by 11 o'cloc tkan, 79 degrees.ee by 2 o'clock, 84.4. yes, little breezy this afternoon. highs today about 85 degrees.5 . right where we should be for bef this time of year and feelinglig very comfortable.omfortable all right, that's a check of the forecast. erin como has the roads onoa o this first day of school foror some folks.so hey, erin. erin. >> that's right, mi

wind: s 5-15. cedar rapids police say a man pulled from a house fire this morning has died of his injuries. police say firefighters had to pull 22 year old naquave whitlock from the burning home at 611 a avenue nw. crews responded just before 2 this morning. when they arrived, a neighbor used a ladder to rescue a 20 year old woman from the home. she suffered no life threatening injuries. first responders took both to the hospital, but doctors pronounced whitlock dead when he arrived. the home sustained significant damage. crews say a frying pot with grease was left unattended and started the fire. firefighters are on long days conditions. in california, a destructive wildfire continues to grow, where officials put more than 2,400 people under evacuation orders. it's also destroyed 36 homes and 16 other buildings. this is video from a fire burning in santa barbara county. one firefighter explains why it's so difficult fighting fires in california. "brendan halle, vista fire dept. - "i think the stat

, low 90's later today. nicole: all right, maria molina, thank you very much. lauren: thanks, maria. donald trump sets to reboot campaign on economy in detroit. hillary clinton is counterpunching. newt gringrich defending trump on fox sunday. >> it's very tricky if you've never run to public office. he's made some mistakes. lauren: we will tell you what to expect from trump's big speech coming up. facebook rolls latest example of how it's putting video first. check in u.s. stock market futures ahead of opening bell, dow futures up 43, s&p futures and nasdaq up 5 and 15 points respectably, both closed at record back on friday. you're watching fbn:am, first look at morning markets and breaking news. ♪ [announcer] is it a force of nature? or a sales event? the summer of audi sales event is here. get up to a $5,000 bonus on select audi models. or building the best houses in town. or becoming the next highly-unlikely dotcom superstar. and us, we'll be right there with you, helping with the questions you need an